Stem-loop sequence mes-MIR828a

AccessionMI0024345 (change log)
DescriptionManihot esculenta miR828a stem-loop
Gene family MIPF0000544; MIR828
Literature search

3 open access papers mention mes-MIR828a
(6 sentences)

Stem-loop
         --         u                 uc  --au      u     uu   ua     ucucc     uuuucuuuc 
5' ccuccu  uguaauguu cuugcucaaaugaguau  ca    cacagu gcauu  gca  cacaa     uuugc         a
   ||||||  ||||||||| |||||||||||||||||  ||    |||||| |||||  |||  |||||     |||||         g
3' ggaggg  auauuguaa gaacgaguuuacucgua  gu    gugucg cguag  cgu  guguu     aaaug         u
         ua         u                 ga  cucu      u     -u   ug     ---uu     ucaccucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06377: 35055-35221 [-]
intergenic
Database links

Mature sequence mes-miR828a

Accession MIMAT0029303
Sequence

16 - 

ucuugcucaaaugaguauucca

 - 37

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).