Stem-loop sequence mes-MIR1446

AccessionMI0024347 (change log)
DescriptionManihot esculenta miR1446 stem-loop
Literature search

1 open access papers mention mes-MIR1446
(1 sentences)

Stem-loop
         -  c        c      c    c u        ---      aa      uaucaaacc 
5' uagaga cu agcuuuuu ugaacu ucuc c cauaggcu   ucucaa  cuugcc         u
   |||||| || |||||||| |||||| |||| | ||||||||   ||||||  ||||||         c
3' gucucu gg uugaaaaa acuuga agag g guauccga   agaguu  gaacgg         c
         u  u        a      a    u -        aga      -a      uuaaauaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12262: 17213-17343 [+]
intergenic
Database links

Mature sequence mes-miR1446

Accession MIMAT0029305
Sequence

16 - 

uucugaacucucucccucau

 - 35

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).