Stem-loop sequence mes-MIR2275

AccessionMI0024350 (change log)
DescriptionManihot esculenta miR2275 stem-loop
Literature search

2 open access papers mention mes-MIR2275
(9 sentences)

Stem-loop
       u   -     a       -         cu    accuuuuu 
5' caca auc uugaa gugagau uuggaggaa  caaa        g
   |||| ||| ||||| ||||||| |||||||||  ||||        u
3' gugu ugg aacuu cauucua aaccuccuu  guuu        a
       u   u     c       u         ug    cgucuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03614: 1186825-1186917 [+]
intergenic
Database links

Mature sequence mes-miR2275

Accession MIMAT0029308
Sequence

56 - 

uuugguuuccuccaauaucuua

 - 77

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).