Stem-loop sequence mes-MIR2950

AccessionMI0024351 (change log)
DescriptionManihot esculenta miR2950 stem-loop
Literature search

1 open access papers mention mes-MIR2950
(2 sentences)

Stem-loop
           u               u         ug a     aaauuucg  ca 
5' cauggguu augguguauuccauc cuugcacac  g ccagu        gc  c
   |||||||| ||||||||||||||| |||||||||  | |||||        ||  u
3' guaucuag uacuacauaagguag gaacgugug  u gguca        cg  u
           u               u         gu -     --------  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03235: 191672-191775 [-]
intergenic
Database links

Mature sequence mes-miR2950

Accession MIMAT0029309
Sequence

18 - 

uuccaucucuugcacacugga

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).