Stem-loop sequence ipu-mir-100-1

AccessionMI0024456 (change log)
DescriptionIctalurus punctatus miR-100-1 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --a   cg     c   a      g  ac 
5'    acc  uagau cga cuugug ug  u
      |||  ||||| ||| |||||| ||   
3'    ugg  aucua guu gaacac ac  g
   cua   au     u   c      -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-100

Accession MIMAT0029385
Sequence

1 - 

aacccguagauccgaacuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1