Stem-loop sequence ipu-mir-107a

AccessionMI0024462 (change log)
DescriptionIctalurus punctatus miR-107a stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   ---    u  u          u    ugg a 
5'    agcu cu uacaguguug cuug   c u
      |||| || |||||||||| ||||   | g
3'    ucgg ga auguuacgac gaac   g g
   cua    -  c          -    -ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-107a

Accession MIMAT0029389
Sequence

38 - 

agcagcauuguacagggcuauc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1