Stem-loop sequence ipu-mir-10b-2

AccessionMI0024466 (change log)
DescriptionIctalurus punctatus miR-10b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -uac        ac  a       uccaaaa 
5'     ccuguaga  cg auuugug       c
       ||||||||  || |||||||        
3'     ggacaucu  gc uaaacgc       a
   auaa        cu  a       uaaaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-10b

Accession MIMAT0029392
Sequence

1 - 

uacccuguagaaccgaauuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1