Stem-loop sequence ipu-mir-10c

AccessionMI0024467 (change log)
DescriptionIctalurus punctatus miR-10c stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --   -   g     c          uaaacag 
5'   uac ccu uagau cggauuugug       a
     ||| ||| ||||| ||||||||||        
3'   aug ggg aucua gcuuaaacac       c
   gu   a   g     u          ugacacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-10c

Accession MIMAT0029393
Sequence

1 - 

uacccuguagauccggauuugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1