Stem-loop sequence ipu-mir-126a

AccessionMI0024481 (change log)
DescriptionIctalurus punctatus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Stem-loop
   --           u       c --cu  gc 
5'   cauuauuacuu ugguacg g    ag  c
     ||||||||||| ||||||| |    ||   
3'   guaauaaugag gccaugc c    uc  a
   ac           u       u aaac  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-126a

Accession MIMAT0029400
Sequence

39 - 

ucguaccgugaguaauaaugca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1