Stem-loop sequence ipu-mir-126b

AccessionMI0024482 (change log)
DescriptionIctalurus punctatus miR-126b stem-loop
Gene family MIPF0000115; mir-126
Stem-loop
   --           u       c cuaugc 
5'   cauuauuacuu ugguacg g      c
     ||||||||||| ||||||| |      a
3'   gugauaaugag gccaugc c      c
   ac           u       u aacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-126b

Accession MIMAT0029401
Sequence

1 - 

cauuauuacuuuugguacgcg

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1