Stem-loop sequence ipu-mir-132a

AccessionMI0024491 (change log)
DescriptionIctalurus punctatus miR-132a stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   --         u            gua    u 
5'   accguggcu uagauuguuacu   gcgu g
     ||||||||| ||||||||||||   ||||  
3'   ugguaccga aucugacaaugg   ugca g
   gc         c            ---    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-132a

Accession MIMAT0029405
Sequence

1 - 

accguggcuuuagauuguuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1