Stem-loop sequence ipu-mir-133b

AccessionMI0024494 (change log)
DescriptionIctalurus punctatus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --     ca  u  a     gu ag  gu 
5'   cuggu  aa gg accaa  c  gu  u
     |||||  || || |||||  |  ||   
3'   gacca  uu cc ugguu  g  cg  u
   uc     ac  c  c     ug ag  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-133b

Accession MIMAT0029408
Sequence

38 - 

uuugguccccuucaaccagcu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1