Stem-loop sequence ipu-mir-148

AccessionMI0024514 (change log)
DescriptionIctalurus punctatus miR-148 stem-loop
Gene family MIPF0000056; mir-148
Stem-loop
   ---            a    cc    - uga 
5'    aaguucugugau cacu  gacu c   a
      |||||||||||| ||||  |||| |   u
3'    uucaagacauua guga  cuga g   g
   ugu            c    --    c uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-148

Accession MIMAT0029425
Sequence

38 - 

ucagugcauuacagaacuuugu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1