Stem-loop sequence ipu-mir-155

AccessionMI0024518 (change log)
DescriptionIctalurus punctatus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Stem-loop
   --           c  g     g     gu 
5'   uuaaugcuaau gu auagg guuua  g
     ||||||||||| || ||||| |||||  c
3'   aauuacgauug cg uaucc caagu  u
   cu           u  -     a     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-155

Accession MIMAT0029429
Sequence

1 - 

uuaaugcuaaucgugauagggguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1