Stem-loop sequence ipu-mir-19a-1

AccessionMI0024551 (change log)
DescriptionIctalurus punctatus miR-19a-1 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   --            --      uacaagaa   g 
5'   aguuuugcauag  uugcac        aac g
     ||||||||||||  ||||||        |||  
3'   ucaaaacguauc  aacgug        uug g
   ag            ua      --------   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-19a

Accession MIMAT0029451
Sequence

1 - 

aguuuugcauaguugcacuac

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1