Stem-loop sequence ipu-mir-204-2

AccessionMI0024560 (change log)
DescriptionIctalurus punctatus miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   --          ca     u    g  guu 
5'   uucccuuugu  uccua gccu ca   c
     ||||||||||  ||||| |||| ||    
3'   gagggaaacg  agggu cgga gu   c
   ug          ac     -    -  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-204

Accession MIMAT0029459
Sequence

1 - 

uucccuuugucauccuaugccu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1