Stem-loop sequence ipu-mir-206-2

AccessionMI0024565 (change log)
DescriptionIctalurus punctatus miR-206-2 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --                cc     uucag 
5'   acauacuuccuuauau  ccaua     a
     ||||||||||||||||  |||||     a
3'   ugugugaaggaaugua  gguau     u
   gg                -a     cuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-206

Accession MIMAT0029461
Sequence

39 - 

uggaauguaaggaagugugugg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1