Stem-loop sequence ipu-mir-216a

AccessionMI0024573 (change log)
DescriptionIctalurus punctatus miR-216a stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   --u         u   aa       --ua   u 
5'    aaucucagc ggc  cugugag    gug u
      ||||||||| |||  |||||||    |||  
3'    uuggggucg ucg  gacacuc    uac u
   guc         -   cg       uccc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-216a

Accession MIMAT0029467
Sequence

1 - 

uaaucucagcuggcaacuguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1