Stem-loop sequence ipu-mir-218a-2

AccessionMI0024579 (change log)
DescriptionIctalurus punctatus miR-218a-2 stem-loop
Gene family MIPF0000026; mir-218
Stem-loop
   --uu         cu        ---    gca 
5'     gugcuugau  aaccaugu   gguu   g
       |||||||||  ||||||||   ||||   a
3'     cacgaacug  uugguaca   ucag   c
   guac         uc        uaa    acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-218a

Accession MIMAT0029472
Sequence

1 - 

uugugcuugaucuaaccaug

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1