Stem-loop sequence ipu-mir-221-3

AccessionMI0024586 (change log)
DescriptionIctalurus punctatus miR-221-3 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   --   uac     -       g u 
5'   agc   auugu cugcugg u u
     |||   ||||| ||||||| |  
3'   ucg   uaaua gacgacc g c
   uc   ucu     a       g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-221

Accession MIMAT0029476
Sequence

1 - 

agcuacauugucugcuggguuu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1