Stem-loop sequence ipu-mir-23a-1

AccessionMI0024593 (change log)
DescriptionIctalurus punctatus miR-23a-1 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   --            cc       gguggauaaa  g 
5'   ggguuccuggca  gugauuu          ca a
     ||||||||||||  |||||||          ||  
3'   uuuagggaccgu  cacuaaa          gu a
   cc            ua       ---------a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-23a

Accession MIMAT0029481
Sequence

43 - 

aucacauugccagggauuucc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1