Stem-loop sequence ipu-mir-23b-2

AccessionMI0024594 (change log)
DescriptionIctalurus punctatus miR-23b-2 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   --g           -  c      gugacu 
5'    gguuccuggcg ug ugauuu      u
      ||||||||||| || ||||||       
3'    uuagggaccgu ac acuaaa      a
   cca           u  -      aauaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-23b

Accession MIMAT0029482
Sequence

38 - 

aucacauugccagggauuacc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1