Stem-loop sequence ipu-mir-23b-1

AccessionMI0024595 (change log)
DescriptionIctalurus punctatus miR-23b-1 stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
   --g           -  c      ---gug  u 
5'    gguucuuggca ug ugauuu      ac g
      ||||||||||| || ||||||      ||  
3'    uuagggaccgu ac acuaaa      ug u
   cca           u  -      aaaaaa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-23b

Accession MIMAT0029482
Sequence

41 - 

aucacauugccagggauuacc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1