Stem-loop sequence ipu-mir-26a-3

AccessionMI0024601 (change log)
DescriptionIctalurus punctatus miR-26a-3 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --uu         c          uugug   u 
5'     caaguaauc aggauaggcu     gac a
       ||||||||| ||||||||||     |||  
3'     guucauugg ucuuguccgg     uug g
   ucac         u          -----   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-26a

Accession MIMAT0029485
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1