Stem-loop sequence ipu-mir-27e

AccessionMI0024608 (change log)
DescriptionIctalurus punctatus miR-27e stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   --a           aucg       u ga  cc 
5'    gagcuuagcua    gugagca u  uc  u
      |||||||||||    ||||||| |  ||   
3'    cuugaaucggu    cacuugu a  ag  u
   uga           --ga       c aa  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-27e

Accession MIMAT0029491
Sequence

44 - 

uucacaguggcuaaguucagu

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1