Stem-loop sequence ipu-mir-30b

AccessionMI0024614 (change log)
DescriptionIctalurus punctatus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u           a a       gugag u 
5'    guaaacauccu c cucagcu     c g
      ||||||||||| | |||||||     |  
3'    cguuuguggga g gggucgg     g c
   ugu           g c       -agca a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-30b

Accession MIMAT0029497
Sequence

1 - 

uguaaacauccuacacucagcu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1