Stem-loop sequence ipu-mir-375-1

AccessionMI0024628 (change log)
DescriptionIctalurus punctatus miR-375-1 stem-loop
Gene family MIPF0000114; mir-375
Stem-loop
   -    u     ac   c    u  a  ug 
5'  acgu gagcc  acg acaa ac ug  g
    |||| |||||  ||| |||| || ||   
3'  ugcg cucgg  ugc uguu ug ac  a
   u    -     cu   u    u  -  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-375

Accession MIMAT0029508
Sequence

37 - 

uuuguucguucggcucgcguu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1