Stem-loop sequence ipu-mir-429a

AccessionMI0024630 (change log)
DescriptionIctalurus punctatus miR-429a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --  c          ug      ug   u 
5'   gu uuaccagaca  guuaga  uaa a
     || ||||||||||  ||||||  |||  
3'   cg aauggucugu  uaaucu  guu a
   gc  u          ca      gu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-429a

Accession MIMAT0029509
Sequence

38 - 

uaauacugucugguaaugccg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1