Stem-loop sequence ipu-mir-429b

AccessionMI0024631 (change log)
DescriptionIctalurus punctatus miR-429b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   ---uc          a  -     ug ug 
5'      uuaccaggca gu uuaga  u  a
        |||||||||| || |||||  |  u
3'      aaugguccgu ca aaucu  g  a
   accgu          -  u     gu uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-429b

Accession MIMAT0029510
Sequence

36 - 

uaauacugccugguaaugcca

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1