Stem-loop sequence ipu-mir-455b

AccessionMI0024634 (change log)
DescriptionIctalurus punctatus miR-455b stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ----         u      a   u   gag 
5'     uaugugccc uggacu cau gug   g
       ||||||||| |||||| ||| |||    
3'     auauacggg accuga gua cac   c
   ucac         u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-455b

Accession MIMAT0029513
Sequence

1 - 

uaugugcccuuggacuacauug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1