Stem-loop sequence ipu-mir-9-1

AccessionMI0024660 (change log)
DescriptionIctalurus punctatus miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention ipu-mir-9-1
(5 sentences)

Stem-loop 
   --uc               g     ---   u 
5'     uuugguuaucuagcu uauga   gug u
       ||||||||||||||| |||||   ||| a
3'     aagccaauagaucga auacu   uac u
   auga               a     ucu   u
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-9

Accession MIMAT0029528
Sequence

1 -  

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23342099 "Identification and characterization of microRNAs in channel catfish (Ictalurus punctatus) by using Solexa sequencing technology" Xu Z, Chen J, Li X, Ge J, Pan J, Xu X PLoS One. 8:e54174(2013).