Stem-loop sequence ipu-mir-99a

AccessionMI0024668 (change log)
DescriptionIctalurus punctatus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   -a         uc   u    ---  g  u 
5'   acccguaga  cga cuug   ug cg a
     |||||||||  ||| ||||   || ||  
3'   ugggugucu  gcu gaac   ac gc a
   uc         ua   c    cca  g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-99a

Accession MIMAT0029532
Sequence

1 - 

aacccguagauccgaucuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1