Stem-loop sequence ipu-mir-7560

AccessionMI0024692 (change log)
DescriptionIctalurus punctatus miR-7560 stem-loop
Stem-loop
   -ua         aa  uu     ga    c 
5'    ccugucugc  uc  gaagc  augg a
      |||||||||  ||  |||||  ||||  
3'    ggguagacg  ag  cuuug  uguc c
   aca         -g  uc     -a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7560

Accession MIMAT0029556
Sequence

1 - 

uaccugucugcaaucuugaagc

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1