Stem-loop sequence ipu-mir-7561

AccessionMI0024694 (change log)
DescriptionIctalurus punctatus miR-7561 stem-loop
Stem-loop
   -- u        -  uuc    u    ---   cg 
5'   g cgaguucg cu   cuga ucaa   agu  c
     | |||||||| ||   |||| ||||   |||  a
3'   c gcucgagc ga   gacu aguu   uca  u
   uu -        u  ---    u    cuu   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7561

Accession MIMAT0029558
Sequence

42 - 

ugauucagagucgagcucgcuu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1