Stem-loop sequence mmu-mir-7646

AccessionMI0024984 (change log)
Symbol MGI:Mir7646
DescriptionMus musculus miR-7646 stem-loop
Stem-loop
   --ac      ac         cu  ag 
5'     aagaga  ugaucagug  ga  u
       ||||||  |||||||||  ||  a
3'     uucucu  gcuggucac  cu  a
   cacu      -c         uc  gu 
Get sequence
Deep sequencing
267 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 135746716-135746769 [+]
sense
OTTMUST00000045110 ; Gprasp1-001; intron 2
OTTMUST00000045114 ; Gprasp1-005; intron 2
OTTMUST00000045111 ; Gprasp1-002; intron 3
OTTMUST00000045112 ; Gprasp1-003; intron 3
OTTMUST00000045113 ; Gprasp1-004; intron 3
OTTMUST00000045137 ; Armcx5-001; 3'UTR (exon 4)
ENSMUST00000113144 ; Gprasp1-001; intron 2
ENSMUST00000143034 ; Gprasp1-005; intron 2
ENSMUST00000113147 ; Gprasp1-002; intron 3
ENSMUST00000113145 ; Gprasp1-003; intron 3
ENSMUST00000149595 ; Gprasp1-004; intron 3
ENSMUST00000096321 ; Armcx5-001; 3'UTR (exon 4)
Database links

Mature sequence mmu-miR-7646-5p

Accession MIMAT0029794
Sequence

1 - 

acaagagaacugaucagugcug

 - 22

Get sequence
Deep sequencing257 reads, 43 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7646-3p

Accession MIMAT0029795
Sequence

34 - 

ucacuggucgcucucuuucac

 - 54

Get sequence
Deep sequencing7 reads, 7 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1