Stem-loop sequence mmu-mir-7649

AccessionMI0024987 (change log)
Symbol MGI:Mir7649
DescriptionMus musculus miR-7649 stem-loop
Stem-loop
   --u    -         u   c   g c 
5'    gaca gcagugcug aga aug u u
      |||| ||||||||| ||| ||| | c
3'    uugu cgucacgac ucu uac a u
   ucu    u         c   c   g c 
Get sequence
Deep sequencing
361 reads, 19.4 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 128974840-128974895 [-]
sense
OTTMUST00000070927 ; RP23-205D10.2-001; exon 1
ENSMUST00000141700 ; Gm15987-001; exon 1
antisense
OTTMUST00000070926 ; Clec2g-003; intron 1
OTTMUST00000072343 ; Clec2g-001; intron 2
ENSMUST00000142388 ; Clec2g-003; intron 1
ENSMUST00000000254 ; Clec2g-001; intron 2
Database links

Mature sequence mmu-miR-7649-5p

Accession MIMAT0029800
Sequence

1 - 

ugacagcagugcuguagacaug

 - 22

Get sequence
Deep sequencing112 reads, 17 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7649-3p

Accession MIMAT0029801
Sequence

34 - 

ucucuccagcacugcuuguuucu

 - 56

Get sequence
Deep sequencing241 reads, 23 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1