Stem-loop sequence mmu-mir-7658

AccessionMI0024998 (change log)
Symbol MGI:Mir7658
DescriptionMus musculus miR-7658 stem-loop
Stem-loop
   --u     c u  -c    c   a cu c 
5'    guggg g gg  ggug ugg g  g u
      ||||| | ||  |||| ||| |  | c
3'    caccc c cc  ccac acc c  c a
   ucg     a u  uu    c   - uu a 
Get sequence
Deep sequencing
215 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 156230059-156230115 [-]
sense
ENSMUST00000105569 ; Klhl17-201; exon 12
Database links

Mature sequence mmu-miR-7658-5p

Accession MIMAT0029822
Sequence

1 - 

ugugggcguggcggugcugg

 - 20

Get sequence
Deep sequencing171 reads, 30 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7658-3p

Accession MIMAT0029823
Sequence

37 - 

accaccuuccucacccacgcu

 - 57

Get sequence
Deep sequencing42 reads, 20 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1