Stem-loop sequence mmu-mir-7669

AccessionMI0025009 (change log)
Symbol MGI:Mir7669
DescriptionMus musculus miR-7669 stem-loop
Stem-loop
   ---a  a         a      uu   gu 
5'     gu ccaccauac cagcuu  guu  u
       || ||||||||| ||||||  |||  g
3'     ca gguggugug gucgag  cag  u
   cgua  c         g      --   aa 
Get sequence
Deep sequencing
412 reads, 57.5 reads per million, 80 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 90011153-90011210 [-]
sense
ENSMUST00000029553 ; Ubap2l-201; intron 22
ENSMUST00000064639 ; Ubap2l-202; intron 22
ENSMUST00000090908 ; Ubap2l-203; intron 22
Database links

Mature sequence mmu-miR-7669-5p

Accession MIMAT0029844
Sequence

1 - 

aguaccaccauacacagcuuuug

 - 23

Get sequence
Deep sequencing166 reads, 45 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7669-3p

Accession MIMAT0029845
Sequence

36 - 

gagcugggugugguggcacaugc

 - 58

Get sequence
Deep sequencing246 reads, 64 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1