Stem-loop sequence mmu-mir-7676-2

AccessionMI0025018 (change log)
Symbol MGI:Mir7676-2
DescriptionMus musculus miR-7676-2 stem-loop
Gene family MIPF0001816; mir-7676
Stem-loop
   --a      ua   ug   ucu    aug   c 
5'    gggcag  uga  gcc   gauu   uca u
      ||||||  |||  |||   ||||   |||  
3'    cccguc  acu  ugg   cuag   ggu c
   aca      uc   cg   --c    --a   c 
Get sequence
Deep sequencing
845 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 78348599-78348660 [+]
sense
ENSMUST00000096355 ; Csf2rb-201; 3'UTR (exon 14)
Database links

Mature sequence mmu-miR-7676-5p

Accession MIMAT0029860
Sequence

1 - 

agggcaguaugauggccucugau

 - 23

Get sequence
Deep sequencing1482 reads, 22 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7676-3p

Accession MIMAT0029861
Sequence

41 - 

uccggugcucacucugcccaca

 - 62

Get sequence
Deep sequencing206 reads, 16 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1