Stem-loop sequence mmu-mir-7678

AccessionMI0025023 (change log)
Symbol MGI:Mir7678
DescriptionMus musculus miR-7678 stem-loop
Stem-loop
   -         cu  au     u     --   --u g 
5'  uuacaaggg  gg  aggaa gaucu  agc   g u
    |||||||||  ||  ||||| |||||  |||   |  
3'  gauguucuc  uc  uccuu cugga  uug   c u
   c         uu  au     u     ag   uau c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 164354313-164354383 [-]
intergenic
Database links

Mature sequence mmu-miR-7678-5p

Accession MIMAT0029870
Sequence

1 - 

uuacaagggcuggauaggaau

 - 21

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7678-3p

Accession MIMAT0029871
Sequence

50 - 

uuuccuuacuuucucuuguagc

 - 71

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1