Stem-loop sequence bta-mir-2285y

Accession

MI0025188 (change log)

Description

Bos taurus miR-2285y stem-loop

Gene family

MIPF0000747; mir-2284

Literature search

11 open access papers mention bta-mir-2285y
(15 sentences)

Stem-loop

        a    gc      -   c      a   c       u 
5' uguug guug  caaaaa guu guuugg uuu ucuguaa a
   ||||| ||||  |||||| ||| |||||| ||| |||||||  
3' auaac caac  guuuuu caa caaacc aaa aggcauu u
        c    aa      u   a      c   a       c 

Deep sequencing

6670 reads, 25 reads per million, 68 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr5: 91517938-91518022 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bta-mir-2285y

• bta-mir-2285y: chr5: 91517938-91518022 [+]
• bta-mir-2284z-6: chr5: 91517940-91518019 [-]

Database links

• miRBase Tracker:MI0025188

Mature sequence bta-miR-2285y

• Accession: MIMAT0029944
• Sequence: 52 - aaaacccaaacaaacuuuuuu - 72
• Deep sequencing: 32 reads, 11 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:bta-miR-2285y

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).