Stem-loop sequence bta-mir-2285w

Accession

MI0025189 (change log)

Description

Bos taurus miR-2285w stem-loop

Gene family

MIPF0000747; mir-2284

Literature search

11 open access papers mention bta-mir-2285w
(15 sentences)

Stem-loop

                 -     u      -       c  c  g 
5' uauuggguugacca aaagu cauuca gauuuuc ug aa a
   |||||||||||||| ||||| |||||| ||||||| || ||  
3' auaacccaacuggu uuuca guaagu cuaaaag ac uu u
                 c     u      u       -  a  c 

Deep sequencing

54 reads, 0 reads per million, 17 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr2: 29232948-29233030 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0025189

Mature sequence bta-miR-2285w

• Accession: MIMAT0029945
• Sequence: 11 - accaaaaguucauucagauuu - 31
• Deep sequencing: 53 reads, 17 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:bta-miR-2285w

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).