Stem-loop sequence bta-mir-2285x

Accession

MI0025190 (change log)

Description

Bos taurus miR-2285x stem-loop

Gene family

MIPF0000747; mir-2284

Literature search

11 open access papers mention bta-mir-2285x
(15 sentences)

Stem-loop

                      a   ug      g       aaga 
5' uauauuggguuggccaaaa guu  uucagg uuuuucu    u
   ||||||||||||||||||| |||  |||||| |||||||     
3' auauaauccaaccgguuuu caa  aagucu aaaaagg    g
                      -   gu      -       cauu 

Deep sequencing

1184 reads, 8.7 reads per million, 69 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chr16: 61232048-61232133 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0025190

Mature sequence bta-miR-2285x

• Accession: MIMAT0029946
• Sequence: 51 - gaaaaaucugaaugaacuuuugg - 73
• Deep sequencing: 1092 reads, 69 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:bta-miR-2285x

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).