Stem-loop sequence oar-mir-10a

AccessionMI0025251 (change log)
DescriptionOvis aries miR-10a stem-loop
Gene family MIPF0000033; mir-10
Literature search

4 open access papers mention oar-mir-10a
(19 sentences)

Stem-loop
   ----gauc   --c    uu        a    g     c          uaaggaa 
5'         ugu   uguc  cuguauau cccu uagau cgaauuugug       u
           |||   ||||  |||||||| |||| ||||| ||||||||||        
3'         aca   acag  gauguaua gggg aucua gcuuaaacac       u
   cucgccuc   aau    uu        a    -     u          uaguguu 
Get sequence
Deep sequencing
133439 reads, 2.54e+04 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr11: 37411553-37411661 [+]
intergenic
Database links

Mature sequence oar-miR-10a

Accession MIMAT0030030
Sequence

22 - 

uacccuguagauccgaauuug

 - 42

Get sequence
Deep sequencing133404 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).