Stem-loop sequence hsa-mir-7846

Accession

MI0025516 (change log)

Symbol

HGNC:MIR7846

Description

Homo sapiens miR-7846 stem-loop

Literature search

1 open access papers mention hsa-mir-7846
(2 sentences)

Stem-loop

       c  c    ggc    -   -      g -g   g        - u 
5' gccc gc gccu   cucu ggc ccgcug g  cgc ggcuuucg c u
   |||| || ||||   |||| ||| |||||| |  ||| |||||||| | u
3' cggg cg cgga   gagg ccg ggcgac c  gcg ucgggagc g c
       u  -    aga    u   a      g ga   a        u a 

Deep sequencing

182 reads, 4.35 reads per million, 69 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 12166943-12167038 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000367703 ; TNFRSF8-003; intron 3

  OTTHUMT00000005130 ; TNFRSF8-001; intron 4

  ENST00000514649 ; TNFRSF8-003; intron 3

  ENST00000417814 ; TNFRSF8-201; intron 3

  ENST00000263932 ; TNFRSF8-001; intron 4

Database links

• HGNC:MIR7846
• miRBase Tracker:MI0025516

Mature sequence hsa-miR-7846-3p

• Accession: MIMAT0030421
• Sequence: 68 - cagcggagccuggagagaagg - 88
• Deep sequencing: 142 reads, 51 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-7846-3p
  • miRDB:hsa-miR-7846-3p

References

1. PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).