Stem-loop sequence bta-mir-7859

AccessionMI0025529 (change log)
DescriptionBos taurus miR-7859 stem-loop
Stem-loop 
   --       a  a     a     cu cu 
5'   augugaa uu ccagu uuugu  g  u
     ||||||| || ||||| |||||  |   
3'   uguacuu ga gguca aaaca  c  u
   aa       c  c     a     uc ag
Get sequence
Deep sequencing
1026 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr10: 85934136-85934193 [+]
sense
ENSBTAT00000004878 ; PTGR2-201; intron 4
Database links

Mature sequence bta-miR-7859

Accession MIMAT0030434
Sequence

37 -  

aaaaacuggcagcuucauguaa

 - 58

Get sequence
Deep sequencing962 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).