Stem-loop sequence bta-mir-219-2

AccessionMI0025539 (change log)
DescriptionBos taurus miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Literature search

4 open access papers mention bta-mir-219-2
(7 sentences)

Stem-loop 
   --u   u     a  g         a   ucu 
5'    gau gucca ac caauucucg guc   a
      ||| ||||| || ||||||||| |||   g
3'    cug caggu ug guugagagc cgg   c
   gcc   -     c  a         -   ucu
Get sequence
Deep sequencing
176 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-219

Accession MIMAT0030444
Sequence

42 -  

agaguugagucuggacgucccg

 - 63

Get sequence
Deep sequencing100 reads, 33 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).