![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-8074 |
|||||
Accession | MI0025910 (change log) | ||||
Symbol | HGNC:MIR8074 | ||||
Description | Homo sapiens miR-8074 stem-loop | ||||
Literature search |
1 open access papers mention hsa-mir-8074 | ||||
Stem-loop |
c -cc u a aug - - ccc 5' caguu ugagu uaugc ag c ccauggga g a ||||| ||||| ||||| || | |||||||| | 3' gucaa acuca guacg uc g gguauccu c g a cac u g aga c g aga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-8074 |
|
Accession | MIMAT0031001 |
Sequence |
48 - cuauggcgagacuggcauguacuc - 71 |
Deep sequencing | 9 reads, 6 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:23612084
"Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes"
Shock. 39:480-487(2013).
|