Stem-loop sequence mmu-mir-8111

AccessionMI0026043 (change log)
Symbol MGI:Mir8111
DescriptionMus musculus miR-8111 stem-loop
Stem-loop
   ---      a    --ugc   a         g         c      c    c      c ag   cua 
5'    ccaccu ccuc     cuc ugagugcug gauuaaagg gugcac acca gcccgg g  aua   a
      |||||| ||||     ||| ||||||||| ||||||||| |||||| |||| |||||| |  |||    
3'    ggugga ggag     gag acucacgau cuaguuucc caugug uggu cgggcc c  uau   u
   ccg      c    ucaaa   -         a         a      a    a      a -a   uuu 
Get sequence
Deep sequencing
4547 reads, 5.65e+03 reads per million, 153 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 84005628-84005764 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-8111
mmu-mir-8111chr8: 84005628-84005764 [+]
mmu-mir-1199chr8: 84011515-84011633 [-]
Database links

Mature sequence mmu-miR-8111

Accession MIMAT0031417
Sequence

77 - 

accgggcaugguaguguacac

 - 97

Get sequence
Deep sequencing350 reads, 55 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1