![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ppe-MIR168 |
|||||
Accession | MI0026082 (change log) | ||||
Description | Prunus persica miR168 stem-loop | ||||
Gene family | MIPF0000081; MIR168 | ||||
Literature search |
![]()
6 open access papers mention ppe-MIR168 | ||||
Stem-loop |
uucag g ua c u a gc guuuagg uuuuu ua g u -a a 5' uuacug cggucuc auucg uuggugcagg cggga cu uucgc gccu ucg caa acc aug gcc g |||||| ||||||| ||||| |||||||||| ||||| || ||||| |||| ||| ||| ||| ||| ||| 3' aguggc gccagag uaagu aacuacguuc gcccu gg aagcg uggg ggc guu ugg uac cgg g -gaga - gc c c g ua ------- ----u ug a - cg u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ppe-miR168 |
|
Accession | MIMAT0031454 |
Sequence |
24 - ucgcuuggugcaggucgggaa - 44 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:22909020
"Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs"
BMC Plant Biol. 12:149(2012).
|